Prof Yao-Zhou Zhang, Senior Vice President, Tianjin International Joint Academy of Biotechnology & Medicine stated “TJAB is very keen to develop a significant competency in the antisense technology field. I personally have spent many years in research on gene silencing and RNA targeting approaches, and accordingly am excited by the prospects of working with the second generation antisense technology via our proposed alliance with ANP. We view ATL1102 as the first of what we hope may be a broader group of initiatives or projects to come from the proposed alliance with ANP”.
Its worth the read link is http://www.sumobrain.com/patents/wipo/Method-mobilizing-stem-progenitor-cells/WO2012034194.html
Compound:
ISIS 107248 (CTGAGTCTGTTTTCCATTCT: SEQ ID NO: 1), a 3-9-8 MOE gapmer with a phosphorothioate backbone and 5-methylcystosine for every C that is fully complementary to human a4 integrin (CD49d) was used in these studies. Analysis of this oligonucleotide also known as ATL1102 (h VLA-4 antisense oligonucleotide) and others targeting human VLA-4 in vitro is as described in WO 2000/20635 and US 6,258,790.
The subcutaneous solution for injection contained only ATL1102, in water for injection adjusted to pH 7.4 with acid or base during compounding. The solution was clear with a light yellow color. It was packaged in Type I, flint glass vial that was stoppered with a bromobutyl rubber closure having a Teflon® coating and sealed with an aluminum flip-off overseal.
Treatment of multiple sclerosis patients:
ATL1102 was administered to multiple sclerosis patients in a double blind placebo controlled study and the effect of the drug on the number of brain lesions was determined by magnetic resonance imaging. The treatment details in relapse remitting multiple sclerosis patients (RRMS) and analysis of this oligonucleotide in terms of reduced lesion numbers is as described in WO 2010/008474.
CD34 mobilization studies in an in vivo human model:
Total blood RNA prepared from several MS patients was evaluated for CD34+
(hematopoietic) stem cell and progenitor mobilization. CD34 + cell mobilization was studied in 11 subjects diagnosed with RRMS who received ATL1102 (hVLA-4 antisense oligonucleotide) by subcutaneous injections for whom total blood RNA at week 8 of treatment and baseline was available. RNA isolation and cDNA preparation was as per Example 3 below.
TaqMan real-time quantitative PCR for CD34
Real-time quantitative RT-PCR for CD34 was done as previously described by Oppliger et al, Hematologica 2005 90(7): 875-880.
CD34 RNA transcript analysis
ATL1102 treatment increased CD34 transcripts in total blood RNA 1.5 fold (P<0.027) at week 8 compared to baseline in the 11 matched RRMS patients compared to the PBGD housekeeping gene expressed in all cells in total blood, including red blood cells (Table 4).
Table 4
Example 3: Human VLA-4 RNA Pharmacodynamic Studies
This study evaluated VLA RNA effects using hVLA-4 antisense in the above identified in vivo human multiple sclerosis study in example 2. CD49d RNA levels were detected via PCR in whole blood RNA or fractionated CD4 and CD8 lymphocyte RNA.
RNA isolation
For samples from the east Europe centers, the Paxgene ® Blood RNA System tubes (PreAnalytiX, Qiagen GmbH) were used. 2.5 ml of whole blood was drawn directly in Paxgene ® tubes and treated as indicated in the manufacture's instructions. By this method, intracellular RNA was stabilized until needed. RNA isolation was preformed using the Paxgene ® Kit according to the manufactures instructions.
For samples from the German centers RNA-isolation occurred as follows: 2-8 hours after withdrawal of 24 mL EDTA blood, a pre enrichment of lymphocytes was done using the Ficoll based separation solution LSM 1077 (PAA). Cells were counted and immediately used for magneto-immuno-isolation of CD4+ and CD8+ cells using a CD4 and CD8 positive isolation Kit (Dynal) according to the manufacturer's manual. Purity of CD4 and CD8 isolated cell was checked randomly by flow cytometry. RNA isolation was performed using the RNeasy Kit (Qiagen GmbH) according to the manufacture's instructions. In addition, 2.5 mL of the EDTA blood was directly drawn in a Paxgene ® Blood RNA System tube (PreAnalytiX, Qiagen GmbH) and RNA isolation was preformed using the Paxgene ® Kit according to the manufacture's instructions. cDNA preparation
cDNA was produced as polymerase chain reaction (PCR) template using AffinityScript QPCR cDNA Synthesis Kit (Stratagene). The reaction mixture contained 6 of total RNA, 3µ? of random primers (0.1 µg/µl), 10 µ?, of first strand master mix (2x) and ?µ? ^ of AffinityScript RT/RNase Block enzyme mixture. The reaction was incubated at 25°C for 5 minutes, 42°C for 15 minutes and at 95°C for 5 minutes.
Real-time PCR for amplification of human VLA-4
The PCR was performed on a 7500 Real-Time PCR System (AppliedBiosystems). For the amplification of MTGA4 (VLA-4), the reaction mixture included 5 ng of cDNA, 1.25 µ?, of TaqMan expression assay (20x, Hs00168433_ml, AppliedBiosystems) and 12.5 TaqMan Expression Master Mix (2x,
AppliedBiosystems) in a total volume of 25 µ?. For the amplification of the housekeeping gene hTBP (human TATA box binding protein), the reaction mixture included 5 ng of cDNA, 1.25 µ?, of TaqMan expression assay (20x, Hs00427620_ml, AppliedBiosystems) and 12.5 TaqMan Expression Master Mix (2x,
AppliedBiosystems) in a total volume of 25 µL.
The PCRs for hITGA4 and hTATA were conducted in separate wells as duplicates per run. For each sample, two runs were performed. Each reaction was performed as follows: an initial incubation at 50°C for 2 minutes and enzyme activation at 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. The data collection took place at the 60°C incubation step.
Relative quantification of human VLA-4
The expression level of MTGA4 mRNA in each sample was analyzed by SDS vl .2 software (AppliedBiosystems). The principles and workflows have been described previously (Applied Biosystems User Bulletin No. 2 (P/N 4303859); Livak and Schmittgen, 2001).
Relative quantification determines the change in expression of a nucleic acid sequence (target) in a test sample relative to the same sequence in a calibrator sample (a sample used as the basis for comparative results). The purpose of the endogenous control gene (housekeeping gene) is to normalize the PCR for the amount of RNA added to the reverse transcription reaction. The comparative C T Method (?? C T Method) uses arithmetic formulas to achieve the result for relative quantification. For this method it is not necessary to use standard curves as long as the PCR efficiencies between target and endogenous control are relatively equivalent.
The amount of target, normalized to an endogenous reference (Ct target gene- Ct Endogeneous control = AC T ) and relative to a calibrator (AC T sample-ACx Calibrator = AAC T ), is given by: 2 " ?? C T ; C T = threshold cycle.
In this experiment, the RNA of a healthy untreated test person was used as the calibrator sample and it was verified that the efficiencies of the target- and the housekeeping gene-PCR were comparable (A Efficiency < 0.02). A C T threshold of 0.2000000 and a baseline from cycle 3 to 15 was chosen.
Results
There were no changes in CD49d RNA levels detected in whole blood or fractionated CD4 + and CD8 + lymphocytes on a per microgram basis. CD49d RNA analysis in whole blood may have been affected by the reduction in neutrophils, which cells occur in great numbers in human blood, and are mostly VLA-4 R A negative. Absence of CD49d RNA reduction in CD4 and CD8 lymphocytes indicate ATL1102 reduces VLA-4 RNA on only a select number of blood T cells and absence of reduction in total blood may indicate ATL1102 reduces VLA-4 RNA in only a select number of other blood cells. This is consistent with the observations in examples 4 and 5.
Example 4: Human VLA-4 Cellular Pharmacodynamic Studies
Blood samples were obtained on visits 2 (baseline), 6 (week8), 7 (weekl2), and 8 (week 16) from the RRMS patients in example study 2 for evaluating VLA-4 levels on the cell surface. 36ml whole blood was needed for VLA-4 assay on lymphocytes.
Cell surface antigenic determinants
Multi-channel flow cytometry analysis of patient blood samples for cell surface expression of VLA-4 and markers of leucocyte sub -populations was performed. Studies were conducted on CD3 + T cells, CD4 + T cells, CD8 + T cells, CD19 + B cells and CD14 + monocytes and VLA-4 co-staining was analyzed as VLA-4 MFI or as the percentage of VLA-4 + cells within a given cell population. Measurement of VLA-4 cell surface expression
Whole blood mononuclear cells were analyzed for VLA-4 membrane expression by flow cytometry using the monoclonal antibody (MoAb) fluorescein isothiocyanate (FITC)-conjugated anti-CD49d (VLA-4; Acris Antibodies, Hiddenhausen, Germany). In short, to 200 phosphate buffered saline (PBS), 10 of the VLA-4 MoAb was added. To identify B cells, 10 phycoerythrin (PE)-conjugated anti-CD 19 MoAb was added. To identify monocytes, 2 µ? ^ allophycocyanin (APC)-conjugated anti- CD 14 MoAb was added. To identify T cells and their CD4 + and CD8 + subpopulations, 10 µ? ^ perinidin chlorophyll protein (PerCP)-conjugated anti-CD3 MoAb, 10 µ? ^ PE- conjugated anti-CD4 MoAb, and 2 µ? ^ APC-conjugated anti-CD8 MoAb was added. After addition of 100 µ? ^ EDTA-blood, samples were incubated in the dark for 15 minutes. The erythrocytes were lysed with lysing solution (Becton Dickinson, Heidelberg, Germany) and then washed with PBS. Stained cells were measured with a FACSCalibur (Becton Dickinson) and VLA-4 expression was recorded as percentage of cells as well as mean channel fluorescence intensity (MFI). MoAB directed against B cells, T lymphocytes and monocytes were purchased from Becton Dickinson. Statistical analysis of placebo and baseline comparisons have been performed for the flow cytometry data by two methods. The first method involved analysis of covariance tests of untransformed and log transformed data, with the log transformed data reported below to determine the % reduction, and where data was excluded when there is no corresponding baseline value. The second method involved using a Student T test of untransformed data where all data was included.
Results
B cell surface VLA-4 effects
ATL1102 treatment resulted in a reduction in the percentage of CD19 + B lymphocytes expressing detectable VLA-4. This was observed at week 8 compared to both placebo group and baseline.
In placebo comparisons, an 11% reduction (p < 0.05) was observed by the first method of analysis. An 8.3% reduction (p < 0.013) was observed by the second method analysis of the VLA-4 /CD19 + B cell number data.
In baseline comparisons, a similar reduction in the percentage of VLA- 4 + /CD19 + B cells was observed. An 11%> reduction (p < 0.05) was observed by first method of analysis, and a 7.1%> reduction (p < 0.032) was observed by the second method analysis of the VLA-4 /CD19 + B cell number data.
In other analysis, reductions in VLA-4 MFI were only observed in B cells at week 16 (<10%> reduction ).
T cell surface VLA-4 effects
ATL1102 treatment resulted in a reduction in the percentages of CD3 + and CD4 + cells expressing detectable levels of VLA-4. When analysing data at week 12 compared to baseline, the second method of analysis showed a reduction in the percentage of CD3 + T lymphocytes that were also VLA-4 + (8.2% reduction p < 0.037) and a reduction in the percentage of CD4 + T lymphocytes that were also VLA-4 + (12% reduction p < 0.047).
Conclusion
ATL1102 reduces VLA-4 on a select number of blood B cells and T cells. Example 5: Human Blood Cell Pharmacodynamic Studies
Blood samples were obtained on visits 2, 6, 7, and 8 from the R MS patients in example study 2 for evaluating blood cell changes. Cell changes were assessed using multi-channel flow cytometry as per example 4 and by hematology.
CD8 + / CD4 + Measurements:
For evaluation of CD8 + / CD4 + cell count, blood samples were assayed by flow cytometry at visits 2, 6, 7, and 8 using the 36ml blood samples obtained for VLA-4 assay. The ratio of CD4:8 did not change in these studies.
Cell counts: leukocytes
Blood samples were assayed at visits 2, 6, 7, and 8 by hematology and Multi-channel flow cytometry. The following reductions versus placebo were observed at week 8 of treatment with ATL1102 (using the first method of analysis)
Total leucocytes: 37% (p<0.0005)
Granulocytes: 43% (p<0.0005)
Lymphocytes: 25% (p<0.05)
B cells: 53% (p<0.0005)
HLA-DR + B cells: 41% (p<0.05)
CD4 + T cells: 26% (p<0.05)
CD8 + T cells: 23% (p<0.05)
There was also a possible increase in the proportion of CD8 CD25 + T cells (p<0.05) and CD8 HLA-DR T cells (p<0.005) although there were small numbers of these cells.
Conclusion
ATL1102 reduces the number of B cells, T cells and granulocytes (including neutrophils, basophils, and eosinophils (data not shown). ATL1102 does not reduce the number of monocytes, or NK lymphocytes. This data is surprising given that antibodies to VLA-4 would usually increase the number of these cells in the blood (see Example 8).
VLA-4 is known to have a role in the maturation, apoptosis, activation, adhesion and migration of B and T cells (Arroyo et al., 1996; Carrasco and Batista, 2006; Lo et al, 2003; Alter et al, 2003 Tchilian et al, 1997; Nino et al, 2006), one or more of which could contribute to the cellular pharmacodynamic observations in the ATL1102 phase II study. VLA-4 also has a role on neutrophil precursors, eosinophils and basophils.
ATLl 102 derived CD34 + stem and progenitor cells may have few contaminating blood cells that cause autoimmune disease allowing the patients own CD34 + cell to be used in autologous treatment of autoimmune diseases post irradiation. Additionally ATLl 102 stem and progenitor cells harvested according to methods of the disclosure may have fewer contaminating cells with a role in graft versus host disease, allowing better allogenic treatments of leukamias. Unaffected natural killer and dendritic (monocyte) cells in the graft improves disease free survival. ATLl 102 reduces VLA-4 on a select number of blood B cells and T cells which reduces the potential to release tumor cells in patients.
Example 6: Human ATLl 102 Pharmacokinetics studies
Blood samples (7 ml) were obtained on visits 2, 5, 6, and 8 for evaluating oligonucleotide 1 plasma levels. On visits 2, 5, and 6 this was performed prior to and 1, 2, 3, 4, and 6 hours after injection of oligonucelotoide 1/placebo. On visit 8, a single sample was obtained. The blood samples after drawing were centrifuged for 10 minutes at 1,600 g and at a temperature of 4°C 10 minutes. The supernatant was transferred to labeled polypropylene tubes (2 tubes per sample) by pipetting and further transferred to a deep-freezer for storing at a temperature of -20°C (tolerance +5°C) or lower.
Pharmacokinetic Data
Median profiles of ATLl 102 show no indication of accumulating peak or total plasma exposure levels from day 1 to week 8 (Figure 1 and Table 5).
The increase in C m i n concentrations during the treatment phase suggests that oligonuclotide 1 accumulates in tissue with multiple dose administrations. The decrease in C m i n concentrations during the follow-up phase suggests that the t 2 elimination is approximately 3 weeks. Table 5 T ble in .
I PK Parameters of OLIGONUCLEOTIDE 1 ~]
Median plasma concentrations of ATL1102 were determined at serial measurements on day 1 and in week 4 and week 8. After subcutaneous administration, ATL1102 appeared to be rapidly absorbed with measurable concentrations seen at the first post-dose timepoint (1 hour post-dose). Subsequently, all median profiles showed a clear increase from 1 to 2 hours. The day 1 median profile further increased noticeably from 2 to 3 hours post-dose. This was not the case for the week 4 and week 8 median profiles. ATL1102 peak plasma concentrations of the median profiles were attained 2 to 4 hours after injection and declined thereafter with the 6 hour values being clearly below the 4 hour values for all median profiles. Median predose ATL1102 concentrations in week 4 and week 8 were about 100-fold lower than the median concentrations 6 hour after dosing on day 1 and in week 4, respectively.
In general, with subcutaneous administration of ATL1102 three times in week 1 and twice weekly in weeks 2 to 8, there was no indication of accumulating peak (C max ) or total (AUC) plasma exposure levels from day 1 to week 8. However, trough (predose) concentrations clearly increased from week 4 to week 8. Median trough values were 38 ng/mL and 88 ng/mL at week 4 and week 8, respectively. At week 8 all 32 patients had trough levels above their trough levels at week 4. Following planned treatment discontinuation at week 8, ATL1102 median plasma concentrations were 32 ng/mL at week 12 (4 weeks post-dose), and 11 ng/mL at week 16 (8 weeks post-dose).
The pharmacokinetic parameters were calculated from the individual plasma concentration profiles. A total of 100 profiles were evaluated, 34 profiles each at day 1 and week 4 and 32 profiles at week 8.
C max (peak exposure) values ranged from 2889 ng/mL to 24118 ng/mL. The median values were 9773 ng/mL at day 1, 10505 ng/mL at week 4, 9462 ng/mL at week 8, and 9848 ng/mL overall.
The maximum concentration of ATL1102 was observed at an average of 3.3 hours post-dose (day 1), 2.7 hours post-dose (week 4), and 3.2 hours post-dose (week 8). Considering all 100 plasma concentration profiles, the maximum concentration was observed at 2 hours in 28 profiles, at 3 hours in 41 profiles, and at 4 hours in 27 profiles. The median t max was approximately 3 hours after administration of ATL1102.
The individual values of AUCi ast (total exposure) ranged from 13374 hxng/niL to 110909 hxng/niL. The AUCi ast values did not indicate an accumulating effect from day 1 to week 8. The median values were 45847 hxng/mL at day 1, 46074 hxng/niL at week 4, 45344 hxng/mL at week 8, and 45976 hxng/mL overall.
A total of 18 patients had both a week 12 and week 16 measurement of ATL1102 plasma concentrations, which allowed a rough estimate of the terminal elimination half- life tm. The calculated elimination half-lives ranged from 1.8 to 20 weeks with a median of 3.0 weeks, a geometric mean of 3.2 weeks, and a coefficient of variation of 106%. The log-transformed half-lives had a SD of 0.564.
The ATL1102 plasma concentrations appear to be higher in female patients than in male patients by a factor of approximately 1.6. The geometric means of the AUCi ast and C max values were 1.5 to 1.8-fold higher in female patients than in male patients. Future studies with larger number of patients are needed to confirm this apparent gender difference in exposure.
Conclusion
Maximum plasma ATL1102 concentrations were reached about 3 hours after administration and ranged from 2889 ng/niL to 24118 ng/niL (median 9848 ng/niL). The area under the plasma concentration time curve until 6 hours post administration ranged from 13374 hxng/mL to 110909 hxng/mL (median 45976 hxng/mL). There was no indication of accumulating peak (C max ) or total (AUC) plasma exposure levels from day 1 to week 8. Median pre-dose concentrations in week 4 and week 8 were about 100 fold lower than the median concentrations 6 hours after the dosing on day 1 and in week 4, respectively. There was an increase in pre-dose concentrations from week 4 (median 38 ng/niL) to week 8 (median 88 ng/niL), suggesting ATL1102 accumulation in tissue upon multiple dose administration. The median terminal elimination half-life estimated from only 2 points (4 and 8 weeks after the last administration) was 3 weeks. Example 7: ATLl 102 Pharmacokinetics studies in rats
Sprague-Dawley rats were injected with single intravenous bolus injections of H-ATL1102 (ISIS 107248). The mean concentration of radioactivity in plasma, blood and tissues determined at a mean dose of 5mg/Kg in male rats using liquid scintillation counting. Table 6 below presents summary information of the ATLl 102 blood/plasma and tissue concentration measurements by the minute (min) and hour (hr) or days (d). Blood and plasma are microgram equivalents/ml and tissue concentrations are microgram equivalents per gram of tissue.
ATLl 102 is removed quickly within 4 hours from the blood and plasma to the organs such as the kidney, liver, and primary and secondary immune organs including bone marrow (BM) and Lymph nodes (LN). In the BM excluding femur (BM exf), it had a half life of about 14 days. In the BM femur the half life was longer.
Table 6
No sample was collected where there are blank spaces; LN mand, is the mandibular lymph node.
Male Sprague-Dawley rats were injected with single 19.3 mg/Kg intravenous bolus injections of H-ATL1102 (ISIS107248) and female rats were injected with single 19.7mg/Kg doses. The mean concentration of radioactivity in plasma, blood and bone marrow, kidney and liver is shown below at 4 and 24 hour in Table 7. ATL1102 is lower in plasma than the organs at 4 hours and by 24 hours appears mostly in the kidney liver and bone marrow. In the various bone marrow samples analyzed from different sites, the levels of drug are about the same as liver on a microgram equivalent/gram of tissue in both males and females. Table 7
Example 8: Comparative Human Mature Blood Cell Pharmacodynamic and Pharmacokinetics of an Antisense to VLA-4 Compared to an Antagonist to VLA-4 The novel mechanisms of action of VLA-4 antisense drugs including differentiated pharmacodynamics and pharmacokinetics provide benefits in stem cell/progenitor cell mobilizations used alone and in combination with mobilizing agents G-CSF and/or Mozobil™, particularly when compared to the potential use of VLA-4 antagonist small molecules and antibodies.
Tysabri™, is a monoclonal antibody to the VLA-4 target on the market for the treatment of relapse remitting multiple sclerosis (RRMS) when other treatments like interferon beta or Copaxone fail. Tysabri™ treatment in volunteers and in RRMS affects all VLA-4 + leukocytes in the blood and leads to peripheral sequestration of immune cells. It increases circulating lymphocytes (1.5 fold), including CD4 + , CD8 + and natural killer cells, and B cells more than other lymphocytes (2.8 fold). Tysabri™ increases monocytes, and of the granulocytes increases the eosinophils and basophils, without elevating neutrophils which in humans are virtually all VLA-4 negative (Krumholz et al, 2008; Polman et al, 2006; Putzki et al, 2010; Kivisaak et al, 2009). Tysabri™ has a long half life in blood and prolonged effect of more than a month. It is a potent immunosuppressive drug with the ability to cause JC virus activation and progressive multifocal leukoencephalitis (PML).
In contrast, ATL 1102, an antisense drug to VLA-4, reduces circulating B cells, CD4 + T cells, CD8+ T cells and granulocytes, including neutrophils, eosinophils and basophils, and has no effect on monocytes and natural killer cells cell numbers in the blood. ATL 1102 has a very short half-life in plasma and is rapidly cleared to organs within hours limiting exposure of circulating leukocytes to the drug. These pharmacokinetics, select effect on certain mature blood cells and more select VLA-4 pharmacodynamic effects of treatment outlined in the Example 4 preserves in most blood cells the VLA-4 mediated capacity of adhesion and immunosurveillance.
Example 9: ATL 1102 phase I study
The primary objective of this study was to assess the safety and tolerability of single doses and multiple doses of ATL 1102 given on an escalation dose regimen and injected subcutaneously (SC) to healthy volunteers. Both males and females were entered into the study.
Dosing Regimens
The single subcutaneous injection doses in males in the dose escalation study were 0.1 mg/Kg, 0.5 mg/Kg, l .Omg/Kg, 2.0 mg/Kg, 4.0 mg/Kg and 6.0 mg/Kg. A single intravenous infusion dose in males of 2.0 mg/Kg was also administered over 60 minutes. The multiple subcutaneous injection doses in females were 4.0 mg/Kg administered on days 1, 3, and 5 and 6.0 mg/Kg administered on days 1, 3, and 5.
Subjects were randomised to receive active drug or placebo in a blinded study. Subjects attended the Unit for a single study period. For the escalation single dose schedule, subjects were admitted on the afternoon prior to dosing (day 1) and were discharged, at the discretion of the investigator, approximately 24 hours after dosing was completed. The multiple dose schedule subjects were discharged 24 hours after the third dose. The subjects then returned for a number of outpatient visits (includes up to week 59 for collection of blood samples for pharmacokinetics). The ATL1102 dose was administered by a doctor or nurse as a subcutaneous injection or as an intravenous infusion made up to 100 mL with 0.9% NaCl (saline) over 60 minutes (group 7). The subjects were recumbent or semi-recumbent throughout the infusion.
Subjects were requested to remain recumbent/semi-recumbent for at least 4 hours from the time of dosing. The actual time of the start (and end for group 7 only) of each dose were recorded in the CRF.
Subsequent study days
All subjects returned for blood samples for ATL1102 on days 4, 8, 15, 22 and
29 and subjects dosed from 2mg/Kg upwards also returned on days up to day 59 for ATL1102 pharmokinetics samples. Vital signs (blood pressure and pulse) were obtained from all groups on days 4, 8 and 15. Blood samples for safety laboratory tests were performed 24 hours post dose (days 4, 8, 15 and follow up).
Follow up
A physical examination including blood pressure, temperature and pulse rate, a 12-lead ECG and laboratory safety tests (haematology, clinical chemistry and urinalysis).
Blood sample for ATL1 102 was performed at the subject visit on day 29 for subjects receiving up to lmg/Kg and then on day 59 for subjects receiving 2mg/Kg upwards. Similar assessments were done for multidose studies subjects. Adverse events were assessed at this visit. Pharmacokinetic/pharmacodynamic sampling
Blood samples for ATL1102 assay required (3ml) to be taken to provide approximately 1.6ml of plasma. Samples were collected in lavender top 4.5ml EDTA tubes at pre-dose (baseline) and at 30, 60 and 90 minutes and 2, 2.5, 3, 4, 6, 12, 24 hours and 4, 8, 15, 22, and 29 days post dose for groups 1-3.
For subjects receiving 2mg/Kg to 6mg/Kg single sc doses the samples were also taken on days 43, and 59.
For subjects receiving the 2mg/Kg iv dose samples were taken at pre dose, 30,
60, 70 and 90 minutes post start of infusion and at 2, 3, 4, 6, 8 and 24 hours, and also on days 2, 4, 8, 15, 22, 29, 43, and 59 post dose.
For subjects receiving the multiple sc doses the blood samples were taken on day 1 (after the first dose) and day 5 (after the third dose) for 24 hour drug level profiling on each occasion, and then at different time points, at least up to day 59 post dose.
Laboratory tests
Haematology: Hb, Hct, MCV, MCH, MCHC, RBC, WBC and differential,
Urine: spec, gravity, pH, protein, glucose, blood, ketones, (using 10 sg multisticks). If abnormal dipstick result occurs, urine was sent for microscopy and culture.
Results
There was no increase in the level of white blood cells and no effect on red blood cells or platelets in the short ATLl 102 phase I study, even with multiple doses at 4 and 6mg/Kg.
Example 10: Stem/Progenitor Cell Mobilization in Healthy Volunteers, Non Hodgkin's Lymphoma (NHL) Patients and Multiple Myeloma (MM) Patients
ATLl 102 will be administered to healthy volunteers, non-Hodgkin's lymphoma
(NHL) patients, Multiple Myeloma (MM) patients, to release stem/progenitor cells. It may be administered alone, together with G-CSF agonists, together with Mozobil™, or together with G-CSF plus Mozobil™ or other mobilizing treatments to provide superior mobilization.
Described below is a method for the release of stem and/or progenitor cells using ATLl 102 and the G-CSF analogue Neupogen™. The study is designed with a control to show ATLl 102 + G-CSF is superior to mobilization with G-CSF alone in the release of CD34 + hematopoietic stem and/or progenitor cells. An alternative to daily Neupogen™ (filgastrim) is a single dose of pegfilgrastim (pegylated G-CSF analogue, Neulasta™) long acting G-CSF-Peg dosed once.
Primary objective;
To show ATLl 102 + Neupogen™ hematopoietic progenitor cell mobilization is safe, effective, and superior to mobilization with Neupogen™ alone. Dosing Regimen 1; ATL1102 and G-CSF treatment schedule
Two groups of subjects (10 per group) are treated with daily injections of filgrastrim (G-CSF analogue, agonist Neupogen™) for a period of 4, 5, 6, or 7 days, or as recommended by the manufacturer. Neupogen™ is typically injected sc 10 µg/kg/day daily over 4 days before the first apheresis procedure on day 5, and optionally, on day 5, 6 and 7 if not enough stem/progenitor cells are released.
One group is additionally treated with ATL1102, the hVLA-4 antisense compound, whilst the other group is injected with saline. The hVLA-4 antisense compound is injected to obtain a final antisense dose of 4 mg/kKg per day. The hVLA- 4 antisense compound will be injected daily over 4, 5, 6 or 7 days for a total of 4, 5, 6 or 7 doses or the maximum tolerated dose. The first apheresis procedure is on day 5, and follow up apheresis on days 6 and 7, and if not enough stem cell/progenitor cells are released, apheresis may conducted daily to day 14.
The study is designed to measure the number of CD34 + stem/progenitor cells mobilized/kg in a Neupogen™ regimen including ATL1102, the number of aphereses required to collect a target number of stem/progenitor cells, time to engraftment and safety.
Dosing Regimen 2; ATL1102 and G-CSF treatment schedule
Two groups of subjects (10 per group) are treated with daily injections of filgrastrim (G-CSF analogue, agonist Neupogen™) for a period of 4, 5, 6, or 7 days, or as recommended by the manufacturer. Neupogen™ is typically injected sc 10 µg/kg/day daily over 4 days before the first apheresis procedure on day 5, and optionally, on day 5, 6 and 7 if not enough stem/progenitor cells are released.
One group is additionally treated with ATL1102, the hVLA-4 antisense compound, whilst the other group is injected with saline. The hVLA-4 antisense compound is injected to obtain a final antisense dose of 4 or 6mg/Kg per day. The hVLA-4 antisense compound will be injected every other day on day 1, 3, 5, for a total of 3 doses or the maximum tolerated dose. The first apheresis procedure is on day 5, and follow up apheresis on days 6 and 7, and if not enough stem cell/progenitor cells are released, apheresis may conducted daily to day 14.
The study is designed to measure the number of CD34 + stem/progenitor cells mobilized/kg in a Neupogen™ regimen including ATL1102, the number of aphereses required to collect a target number of stem/progenitor cells, time to engraftment and safety. Laboratory tests
The following tests may be performed.
• Flow cytometric analysis of living cells may be performed with various stem cell/progenitor surface markers to obtain information on the number and type of CD34 + stem cell/progenitor released and other surface markers may be used to assess the leukocyte populations in the blood;
• Clonogenic assays will be performed to determine the clonogenic
progenitors including multipotential/oligopotential CFU-GEMM, erythroid (BFU-E), granulocyte-monocyte (CFU-GM), and megakaryocyte (CFU-Mk). Peripheral blood cells will be plated with various factors and the Colony Forming Units determined on the cultures;
• Stem cell engraftment into mice; the engraftment potential of human peripheral blood stem cell/progenitor cells mobilized and collected may be determined in a NOD-SCID/2m ~ ~ mouse model;
• Stem cell engraftment into humans; the engraftment potential of human peripheral blood stem cell/progenitor cells mobilized and collected will be determined in patients after high dose chemotherapy; The speed of platelet recovery and neutrophil recovery will be explored as well as the long term graft potential;
• Hematology may be performed to assess the leukocyte, platelet, and red blood cell populations in the blood;
• The safety of ATL1102 treatment used with Neupogen™ will be
assessed to determined whether there are any drug related serious adverse events.
Outcomes
• Efficacy variables: The percentage of volunteers or patients that have achieved 2xl0 6 CD34 + cells per Kg. The percentage who have achieved
>5xl0 6 CD34 + cells per Kg of body weight in, for example, 4 or fewer aphereses in NHL, and percentage of patients with > 6xl0 6 CD34 + cells per Kg of body weight in, for example, 2 or fewer aphereses in MM. Assess if engraftment is prompt and durable;
· Safety variables; Lymphoma mobilization will be assessed and major toxicities observed. The above study is expected to show volunteer and patients who are given ATL1102 + Neupogen™, compared to Neupogen™ alone, have more stem and/or progenitor cells available for transplantation.
The above study is expected to determine the number of apheresis collections needed to obtain the target number of stem and/or progenitor cells required for transplantation.
Studies will also assess the number of days it takes for stem and/or progenitor cells to re-engraft in patients who are mobilized with ATL1102 + Neupogen™ compared to Neupogen™ alone.
It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.
All publications discussed and/or referenced herein are incorporated herein in their entirety.
Any discussion of documents, acts, materials, devices, articles or the like which has been included in the present specification is solely for the purpose of providing a context for the present invention. It is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed before the priority date of each claim of this application.
REFERENCES
Alter et al., J. Immunol. (2003) 170:4497-4505
Altschul et al, J. Mol. Biol. (1990) 215:403-410
Arroyo et al, Cell (1996) 85:997-1008
Carrasco and Batista, EMBO (2006) 25:889-899
Colquehoun et al., Transplantation (1993) 56:755-758
Diflo et al, Hepatology (1992) 16:PA278
Elbashir et al, Nature (2001a) 411 :494-498
Elbashir et al, Genes Dev. (2001b) 15: 188-200
Englisch et al., Angewandte Chemie, International Edition (1991) 30:613
Fire et al, Nature (1998) 391 :806-811
Fukunaga et al., Cell (1993) 74: 1079-1087
Gabrilove, Sem. Hematol. (1989) 26: 1-14
Guo and Kempheus, Cell (1995) 81 :61 1-620
Jones et al., Bailliere's Clin. Hematol. (1989) 2:83-11 1
Kivisaak et al, Neurol. (2009) 72(22): 1922-30
Kocher et al., Nature Med. (2001) 7:430-436
Krumbholz et al, Neurology (2008) 71 : 1350-1354
Kuga et al, Biochem. Biophys. Res. Comm. (1989) 159: 103-1 1 1 Lachaux et al, J. Ped. (1993) 123: 1005-1008
Livak and Schmittgen, Methods (2001) 25:402-408
Lo et al., J. Exp. Med. (2003) 197(3):353-361
Lu et al, Arch. Biochem. Biophys. (1989) 268: 81-92
Martin et al., Helv. Chim. Acta (1995) 78:486-504
Montgomery et al, Proc. Natl. Acad. Sci. USA. (1998) 95: 15502-15507
Moore et al., Proc. Natl. Acad. Sci. USA (1987) 84:7134-7138
Nielsen et al, Science (1991) 254, 1497-1500
Nino et al., Ann. Neurol. (2006) 59:748-754
Oppliger et al, Hematologica (2005) 90(7):875-880
Polman et al ., N. Eng. J. Med. (2006) 354:899-910
Putski et al., Eur. Neurol. (2010) 63:31 1-317
Simmons et al, Blood (1992) 80:388-395
Souza et al., Science (1986) 232:61-65
Tabara et al, Science (1998) 282:430-431
Takano et al, Curr. Pharm. Des. (2003) 9: 1121-1 127
Tchilian et al., Immunology (1997) 92:321-327 Teixido et al, J. Clin. Invest. (1992) 90:358-367
Tijsterman et al., Science (2002) 295:694-697
Timmons and Fire, Nature (1998) 395:854
Tuschl et al., Genes Dev. (1999) 13:3191-3197
Welte et al, Proc. Natl. Acad. Sci. USA (1985) 82: 1526-1530 Wendel et al., J. Immunol. (1992) 149:918-924
Williams et al., Nature (1991) 352:438-441
Wright et al, Hepatology (1991) 14:PA48
Zhang and Madden, Genome Res. (1997) 7:649-656
ANP Price at posting:
19.0¢ Sentiment: Buy Disclosure: Held
(20min delay)